Skip to main content

Table 2 Primers used for real time PCR

From: The effects of dietary macronutrient composition on lipid metabolism-associated factor gene expression in the adipose tissue of chickens are influenced by fasting and refeeding

Genea Primers sequence (5′–3′); Forward/Reverse Accession No.
β-actin GTCCACCGCAAATGCTTCTAA/TGCGCATTTATGGGTTTTGTT NM_205518.1
PPARγ CACTGCAGGAACAGAACAAAGAA/TCCACAGAGCGAAACTGACATC NM_001001460.1
C/EBPα CGCGGCAAATCCAAAAAG/GGCGCACGCGGTACTC NM_001031459.1
C/EBPβ GCCGCCCGCCTTTAAA/CCAAACAGTCCGCCTCGTAA NM_205253.2
FABP4 CAGAAGTGGGATGGCAAAGAG/CCAGCAGGTTCCCATCCA NM_204290.1
SREBP1 CATCCATCAACGACAAGATCGT/CTCAGGATCGCCGACTTGTT NM_204126.1
KLF7 GATGCTGGTTTTCCTCACAGTTT/CCTCCTGTCCCAAAAGTGTTCA XM_004942644.2
GATA2 CCACGAAGCAAGGCCAGAT/GGTAGCGGTTGCTCCACAGT XM_015293080.1
AGPAT9 CCCATAGATGCGATCATTTTGA/CGTGAACTTGGCCAACCAT NM_001031145.1
MGLL GCAGACGAGCATAGACTCA/GGGAATAGCCTGGTTTACAA XM_015293082.1
ATGL GCCTCTGCGTAGGCCATGT/GCAGCCGGCGAAGGA NM_001113291.1
CGI-58 CGCCCAGTGGTGAAAC/GCCTTTTTGCCCATCCATAA NM_001278145.1
PLN1 GGAGGACGTGGCATGATGAC/GGCCCTTCCATTCTGCAA NM_001127439.1
ACADL GACATCGGCACTCGGAAGA/CCTGGTGCTCTCCCTGAAGA NM_001006511.2
LPL GACAGCTTGGCACAGTGCAA/CACCCATGGATCACCACAAA NM_205282.1
NPY CATGCAGGGCACCATGAG/CAGCGACAAGGCGAAAGTC M87294.1
NPYR2 TGCCTACACCCGCATATGG/GTTCCCTGCCCCAGGACTA NM_001031128.1
  1. aGene abbreviations: Peroxisome proliferator-activated receptor gamma: PPARγ; CCAAT/enhancer-binding protein alpha and beta: C/EBPα and C/EBPβ, respectively; Fatty acid binding protein 4: FABP4; Sterol regulatory element-binding transcription factor 1: SREBP1; Kruppel-Like Factor 7: KLF7; GATA binding protein 2: GATA2; 1-acylglycerol-3-phosphate O-acyltransferase 9: AGPAT9; Monoglyceride lipase: MGLL; Adipose triglyceride lipase: ATGL; Comparative gene identification-58: CGI-58; Perilipin 1: PLN1; Acyl-CoA dehydrogenase, long chain: ACADL; Lipoprotein lipase: LPL; Neuropeptide Y: NPY; NPY receptor 2: NPYR2